Runinskrifter.net

Ög 110

Objektuppgifter:

Föremål:
Fragment av runsten
Nyckelord:
fragment, runsten, sten
Material:
Sten
Nyckelord:
sten: sten

Utseende:

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: A8B2F1

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
58° 23′ 55.9″15° 29′ 5.4″
RT90 (Rikets Nät)
x (nordning)y (östning)
64751231481268
SWEREF99TM
xy
6473221528339
UTM
UTM ZonÖstningNordning
33V5283396473221
GeoHash
u67h0r5wnf
GeoDNA
eaagcgtcaggggacattcatt

Lokalisering:

Ursprunglig plats:
Osäker

Proveniens:

Plats:
Lagerlunda
Socken:
Kärna socken
Härad:
Hanekinds härad
Landskap:
Östergötland
Land:
Sverige

Datering:

Vikingatid; 725–1100

Motsvarar objekt i FMIS:

Objekt URI:

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: