Runinskrifter.net

Vg 161

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Sten
Nyckelord:
sten: sten

Utseende:

Stil:

Visar profilstil (enligt Gräslund): RAK.

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
57° 50′ 52.7″13° 14′ 29.8″
RT90 (Rikets Nät)
x (nordning)y (östning)
64166061347786
SWEREF99TM
xy
6413142395629
UTM
UTM ZonÖstningNordning
33V3956296413142
GeoHash
u633j6fhzt
GeoDNA
eaagcggcgtcgtgcgcaagtc

Lokalisering:

Ursprunglig plats:
Ja

Proveniens:

Plats:
Skräddargården nr 2, Härna by
Socken:
Härna socken
Härad:
Ås härad
Landskap:
Västergötland
Land:
Sverige

Datering:

V; 980–1015

Motsvarar objekt i FMIS:

Objekt URI:

Länkade bilder:

Obs. att bilderna kan visa andra objekt än just den här inskriften, särskilt i fall där det motsvarande objektet är ett stadslager, arkeologisk kontext, eller museiföremålssamling.

Runsten. Södra Härene – 1969-04-17
CC-BY-SA
URI | Kringla | Källa
Runsten. Södra Härene – 1969-04-17
CC-BY-SA
URI | Kringla | Källa

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: