Runinskrifter.net

383 †

Objektuppgifter:

Föremål:
Fragment av runsten
Nyckelord:
fragment, runsten, sten
Material:
Sandsten
Nyckelord:
sten: sandsten, sten

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 4′ 12.8″17° 34′ 23.2″
RT90 (Rikets Nät)
x (nordning)y (östning)
65512001601400
SWEREF99TM
xy
6550712647507
UTM
UTM ZonÖstningNordning
33V6475076550712
GeoHash
u6s2pckkgm
GeoDNA
eaagctaggttttttcgaatgc

Lokalisering:

Ursprunglig plats:
Osäker

Proveniens:

Plats:
Linga
Socken:
Överjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

Vikingatid; 725–1100

Motsvarar objekt i FMIS:

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: