Runinskrifter.net

353

Objektuppgifter:

Föremål:
Fragment av runsten
Nyckelord:
fragment, runsten, sten
Material:
Granit
Nyckelord:
sten: granit

Utseende:

Stil:

Visar profilstil (enligt Gräslund): Fp.

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: D1F3

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 5′ 24.3″17° 32′ 56.3″
RT90 (Rikets Nät)
x (nordning)y (östning)
65533781599958
SWEREF99TM
xy
6552872646040
UTM
UTM ZonÖstningNordning
33V6460406552872
GeoHash
u6s2pm4bbb
GeoDNA
eaagctaggttttatatgttga

Lokalisering:

Ursprunglig plats:
Osäker

Proveniens:

Plats:
Tällby
Socken:
Överjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

V; 1010–1050

Motsvarar objekt i FMIS:

Objekt URI:

Länkad bild:

Obs. att bilderna kan visa andra objekt än just den här inskriften, särskilt i fall där det motsvarande objektet är ett stadslager, arkeologisk kontext, eller museiföremålssamling.

Telleby – Alf Nordström; Stockholms läns museum;
CC-BY-NC-ND
URI | Kringla | Källa

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: