Runinskrifter.net

350

Även känd som B 692, L 812.

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Granit
Nyckelord:
sten: granit

Utseende:

Stil:

Visar profilstil (enligt Gräslund): Fp.

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: A9B2C11F1

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 6′ 40.0″17° 39′ 38.0″
RT90 (Rikets Nät)
x (nordning)y (östning)
65558901606287
SWEREF99TM
xy
6555460652336
UTM
UTM ZonÖstningNordning
33V6523366555460
GeoHash
u6s83bu50s
GeoDNA
eaagctagtgggctttaagaag

Lokalisering:

Ursprunglig plats:
Nej

Proveniens:

Plats:
Valsta (nu Brandalsund)
Socken:
Ytterjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

Vikingatid; 1010–1050

Motsvarar objekt i FMIS:

Objekt URI:

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: