Runinskrifter.net

349

Även känd som Bautil 689, Liljegren 811.

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Sten
Nyckelord:
sten: sten

Utseende:

Stil:

Visar profilstilar (enligt Gräslund): Pr3, Pr4.

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: A4B1D1E3F3

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 3′ 47.1″17° 35′ 57.7″
RT90 (Rikets Nät)
x (nordning)y (östning)
65504451602926
SWEREF99TM
xy
6549976649042
UTM
UTM ZonÖstningNordning
33V6490426549976
GeoHash
u6s802p7qf
GeoDNA
eaagctagtgggggttttgcct

Lokalisering:

Ursprunglig plats:
Ja

Proveniens:

Plats:
Lideby
Socken:
Ytterjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

V; 1050–1100

Motsvarar objekt i FMIS:

Objekt URI:

Länkad bild:

Obs. att bilderna kan visa andra objekt än just den här inskriften, särskilt i fall där det motsvarande objektet är ett stadslager, arkeologisk kontext, eller museiföremålssamling.

Runsten – Sörmlands museum;
CC-BY-SA
URI | Kringla | Källa

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: