Runinskrifter.net

348

Även känd som B 697, L 804.

Objektuppgifter:

Föremål:
Fragment av runsten
Nyckelord:
fragment, runsten, sten
Material:
Granit
Nyckelord:
sten: granit

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 3′ 32.0″17° 35′ 27.5″
RT90 (Rikets Nät)
x (nordning)y (östning)
65499651602457
SWEREF99TM
xy
6549490648579
UTM
UTM ZonÖstningNordning
33V6485796549490
GeoHash
u6kxbr36gj
GeoDNA
eaagctgacaaaaacagcgcgc

Lokalisering:

Ursprunglig plats:
Nej

Proveniens:

Plats:
Kjulsta
Socken:
Ytterjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

Vikingatid; 725–1100

Motsvarar objekt i FMIS:

Objekt URI:

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: