Runinskrifter.net

347

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Granit
Nyckelord:
sten: granit

Utseende:

Stil:

Visar profilstil (enligt Gräslund): Pr3.

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 6′ 53.1″17° 36′ 4.3″
RT90 (Rikets Nät)
x (nordning)y (östning)
65562021602876
SWEREF99TM
xy
6555730648922
UTM
UTM ZonÖstningNordning
33V6489226555730
GeoHash
u6s8298b36
GeoDNA
eaagctagtgggatgaagttgg

Lokalisering:

Ursprunglig plats:
Osäker

Proveniens:

Plats:
Gersta (nu Gerstaberg)
Socken:
Ytterjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

V; 1050–1080

Motsvarar objekt i FMIS:

Objekt URI:

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: