Runinskrifter.net

346

Även känd som Bautil 691, Liljegren 814.

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Granit
Nyckelord:
sten: granit

Utseende:

Stil:

Visar profilstil (enligt Gräslund): Fp.

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: A1B1D1F3

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 6′ 53.5″17° 35′ 51.6″
RT90 (Rikets Nät)
x (nordning)y (östning)
65562101602674
SWEREF99TM
xy
6555736648720
UTM
UTM ZonÖstningNordning
33V6487206555736
GeoHash
u6s823w1p2
GeoDNA
eaagctagtgggagtccgggct

Lokalisering:

Placering:
I Gerstabergs park.
Ursprunglig plats:
Nej

Proveniens:

Plats:
Gersta (nu Gerstaberg)
Socken:
Ytterjärna socken
Härad:
Öknebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

V; 1010–1050

Motsvarar objekt i FMIS:

Objekt URI:

Länkad bild:

Obs. att bilderna kan visa andra objekt än just den här inskriften, särskilt i fall där det motsvarande objektet är ett stadslager, arkeologisk kontext, eller museiföremålssamling.

SLM M025677 – Sörmlands museum; 1948
CC-BY-SA
URI | Kringla | Källa

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: