Runinskrifter.net

190

Även känd som Liljegren 954.

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Sandsten
Nyckelord:
sten: sandsten, sten

Utseende:

Stil:

Visar profilstil (enligt Gräslund): Pr2.

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
59° 15′ 11.6″17° 29′ 29.7″
RT90 (Rikets Nät)
x (nordning)y (östning)
65714621596209
SWEREF99TM
xy
6570905642073
UTM
UTM ZonÖstningNordning
33V6420736570905
GeoHash
u6s3n48zp3
GeoDNA
eaagctaggtctggagagccct

Lokalisering:

Ursprunglig plats:
Osäker

Proveniens:

Plats:
Ytterenhörna kyrka
Socken:
Ytterenhörna socken
Härad:
Selebo härad
Landskap:
Södermanland
Land:
Sverige

Datering:

V; 1020–1050

Övriga anmärkningar:

Bild av krigare i strid med ett lejonliknande djur.

Motsvarar objekt i FMIS:

Objekt URI:

Länkade bilder:

Obs. att bilderna kan visa andra objekt än just den här inskriften, särskilt i fall där det motsvarande objektet är ett stadslager, arkeologisk kontext, eller museiföremålssamling.

Arkeologi – Sörmlands museum;
CC-BY-SA
URI | Kringla | Källa
Arkeologi – Sörmlands museum; 1964-04-14
CC-BY-SA
URI | Kringla | Källa
Sö190 Ytterenhörna kyrka – Kennerstedt, Lars; Riksantikvarieämbetet; 2016-11-23
PD
URI | Kringla | Källa

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: