Runinskrifter.net

D Fv2013;282C

Objektuppgifter:

Föremål:
Träinskrift
Nyckelord:
träinskrift
Material:
Trä
Nyckelord:
trä: trä

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
61° 13′ 33.1″14° 2′ 34.6″
RT90 (Rikets Nät)
x (nordning)y (östning)
67913101405340
SWEREF99TM
xy
6788322448606
UTM
UTM ZonÖstningNordning
33V4486066788322
GeoHash
u6cur9cf82
GeoDNA
eaagcgacctttctgaactcga

Lokalisering:

Placering:
I högra kammaren till vänster om dörren, inskuren i dörrkarmen.
Ursprunglig plats:
Ja

Proveniens:

Plats:
Prästgården, kyrkhärbret
Socken:
Älvdalens socken
Härad:
Älvdals, Särna och Idre tingslag
Landskap:
Dalarna
Land:
Sverige

Datering:

1286 (dendrokronologisk datering)

Medeltid; c 1286

Motsvarar objekt i FMIS:

Objekt URI: