Runinskrifter.net

Ög 109

Objektuppgifter:

Föremål:
Runsten
Nyckelord:
runsten, sten
Material:
Sten
Nyckelord:
sten: sten

Utseende:

Stil:

Visar profilstilar (enligt Gräslund): Pr2, Pr3?.

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: A2B2C10D1F3

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
58° 23′ 6.8″15° 29′ 44.8″
RT90 (Rikets Nät)
x (nordning)y (östning)
64736001481900
SWEREF99TM
xy
6471707528989
UTM
UTM ZonÖstningNordning
33V5289896471707
GeoHash
u67h0sewtd
GeoDNA
eaagcgtcaggggcggctcata

Nuvarande:

WGS84/ETRS89
LatitudLongitud
58° 23′ 52.3″15° 29′ 3.8″
RT90 (Rikets Nät)
x (nordning)y (östning)
64750101481241
SWEREF99TM
xy
6473108528313
UTM
UTM ZonÖstningNordning
33V5283136473108
GeoHash
u67h0r52hm
GeoDNA
eaagcgtcaggggacattgttg

Lokalisering:

Placering:
Nu vid Lagerlunda.
Ursprunglig plats:
Osäker

Proveniens:

Plats:
Frössle
Socken:
Kärna socken
Härad:
Hanekinds härad
Landskap:
Östergötland
Land:
Sverige

Datering:

V; 1020–1080

Motsvarar objekt i FMIS:

Objekt URI:

Bildlänk:

Länkad bild:

Obs. att bilderna kan visa andra objekt än just den här inskriften, särskilt i fall där det motsvarande objektet är ett stadslager, arkeologisk kontext, eller museiföremålssamling.

Ög109 Frössle – Okänd, Okänd; Riksantikvarieämbetet;
PD
URI | Kringla | Källa

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: