Runinskrifter.net

Ög 108

Objektuppgifter:

Föremål:
Fragment av runsten
Nyckelord:
fragment, runsten, sten
Material:
Sten
Nyckelord:
sten: sten

Utseende:

Korsformer:

Visar 1 kors, med följande former (enligt Lager):

Aspekt:ABCDEFG
Kors 1: A6B1C10?D1F3

Koordinater:

Äldsta belagda:

WGS84/ETRS89
LatitudLongitud
58° 24′ 59.7″15° 31′ 25.0″
RT90 (Rikets Nät)
x (nordning)y (östning)
64770861483544
SWEREF99TM
xy
6475211530590
UTM
UTM ZonÖstningNordning
33V5305906475211
GeoHash
u67h34rvq9
GeoDNA
eaagcgtcagggcgattcctct

Lokalisering:

Ursprunglig plats:
Osäker

Proveniens:

Plats:
Kärna kyrkogård
Socken:
Kärna socken
Härad:
Hanekinds härad
Landskap:
Östergötland
Land:
Sverige

Datering:

V; 725–1100

Motsvarar objekt i FMIS:

Objekt URI:

Referenser:

Mer om den här inskriften finns att läsa i Digitala Sveriges runinskrifter.

Verk som handlar om den här inskriften, ur Svensk runbibliografi: